NOTICE: You are viewing a page of the openwetware wiki. Our "dewikify" feature makes a wiki page appear as a normal web page. In March 2017, this feature will GO AWAY and this URL will redirect to the source URL on our wiki. We're sorry for the inconvenience.

CSAIL logo
Knight Lab

Orders will be placed every Thursday unless otherwise requested.

Needs to be Ordered

  • Lithium Energizer Batteries (50)
  • Labels TZe-231 1/2in tape (8)

Placed Orders

  • Labels TZ-241 White - 18 cassettes
  • Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK) 8 Packs
  • Packing tape
  • 500ml Vacuum Filters (VWR 28199-307) - 1 Box
  • Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
  • Falcon 14ml Snap Cap Tubes (352059)
  • Rechargeable NiMH Battery - 53498-063 VWR (for Pipet-aid) (2)

Received Orders

(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)

  • 384 well Nunc Plate w/ Lid (VWR 82030-992) - 12 boxes of 100 each
  • 30ml epMotion Reservoirs (Cat No. 960051009) - 2 boxes
  • Cresol Red (114480-5GM) - 2 bottles (10g total)
  • PCR SuperMix High Fiedlity (6 boxes)
  • NALGENE cryoware cryogenic vials Cat #5000-0020 - 1 Case (sent incorrect type)
  • NUNC Universal Lids (VWR 73520-150, Nunc 250002) - 2 Boxes
  • Adhesive Foil (60941-076) - 30 boxes of 50 each
  • 50ml Conical Tubes (Corning 430290 or VWR 20171-028) - 1 Case
  • Red Skirted PCR Plates (Cat No. 951020486) - 2 boxes
  • TE (17890) - 2L
  • 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
  • VWR reservoirs - 89094-658 2 boxes
  • Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
  • Invitrogen CC
    • 48-well e-gels (1 box)
    • PCR supermix (1 box)
  • 10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500)
  • PCR supermix - 4 boxes
  • E-gel 48 (G800801) - 5 boxes
  • E-gel 12-well (G501808) - 3 boxes
  • PCR supermix (6) 4/29
  • PCR supermix (6) 4/28
  • 6 - P-Touch Labels TZ241 (Black Print on White labels)
  • VWR Foil Seals - 60941-076 - 10 boxes (ordered 15)
  • 1.2ml MC Tips RT-L1200F - 2 boxes
  • Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
  • Ethanol 200 and 190 proof
  • Plasmid Prep Kit 10pc kit 2300210
  • Cardboard Boxes (MD664) (25per pack) - 5 packs for Teams, 8 packs for Labs
  • Bubble Wrap (Staples 468264) - 4 boxes for Labs
  • Packing Tape (Staples 473975) - 2 packs* TE - 17890 - 2 L
  • Invitrogen PCR SuperMix High Fidelity (10790-020) - 9 boxes
  • Primer for Linearized BB - gccgctgcagtccggcaaaaaaacg "SB-prep-3P"
  • Primer for Linearized BB - atgaattccagaaatcatccttagcg "SB-prep-2Ea"
  • Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
  • Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992 (did 8 before)
  • Primer PBB-ior-R - tttgcaagcagcagattacg
  • Primer PBB-ior-F - tgaccaaaatcccttaacgtg
  • Primer PBB-eoro-R - gctgaagccagttaccttcg
  • Primer PBB-eoro-F - cgtcagaccccgtagaaaag
  • Primer PBB-TETR-R - ctcatgagcgcttgtttcg
  • Primer PBB-TETR-F - cgactcctgcattaggaagc
  • Primer PBB-KANR-R - cgctcgtcatcaaaatcactc
  • Primer PBB-KANR-F - tgttgatgcgctggcagt
  • Primer PBB-CMR-R - gggcgaagaagttgtccata
  • Primer PBB-CMR-F - cgatttccggcagtttctac
  • Primer PBB-AMPR-R - caacgttgttgccattgct
  • Primer PBB-AMPR-F - tctgacaacgatcggaggac
  • Primer PBB-AMPR-Long-F - gcggccaacttacttctgac
  • Primer PBB-CMR-Long-F - tacaccgttttccatgagca
  • Primer PBB-KANR-Long-F - gggaaaacagcattccaggt
  • Primer PBB-TETR-Long-R - cctatatcgccgacatcacc
  • Nunc 384 deep well plates - 269390 - 2 boxes VWR 73521-278
  • Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992
  • Clear Plate Lids - 300 lids (VWR 73520-150, Nunc 250002)
  • 3M Micropore Tape (2 boxes)
  • Double Sided Foam Tape (10 rolls)
  • White Swan small women's Lab Coat (VWR# 80092-446)
  • Hand Soap (3 bottles)
  • 1ml epMotion Tip Racks - 960050088 - 2 boxes (ordered 3)
  • 48w E-gels - G8008-01 - 4 boxes
  • VF2/VR primers for Genewiz
  • Multi-channel Pipette: Pipet-Lite LTS 8-channel, 20 µl to 200 µl L8-200
  • Multi-channel Pipette: Pipet-Lite LTS 8-channel, 5 µl to 50 µl L8-50
  • SR-L250S Pipette Tips - 8 boxes (contains 5 tip racks each)
  • 10ul Tip Racks (SR-L10F) - 8 boxes (contains 5 tip racks each)
  • 1.2ml MC Tip Racks - RT-L1200F - 2 boxes
  • BSA - B9001S - 1 pack (4tubesx1.5ml)
  • NEB Buffer 2 - B7002S - 1 pack
  • 20ul Tips VWR - 2 boxes (14217-726)
  • 200ul Tips VWR - 2 boxes (14217-728)
  • 100 ml epMotion Reservoirs - 960051017 - 1 box
  • 1ml epMotion Tip Racks - 960050088 - 8 boxes
  • Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
  • 96 well Round Bottom Plates - 3958 - 2 boxes
  • 96 deep well Plates - 3960 - 4 boxes
  • Petri Dishes (2 boxes) 25384-250
  • Bleach
  • Inoculating Loops 12000-806
  • clear, skirted PCR Plate - 47744-124 - 4 boxes
  • Foil Covers - 60941-076 - 40 boxes
  • VWR reservoirs - 89094-658 2 boxes
  • TE (2 bottles) Thermo Scientific # 17890
  • Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
  • Corning 96-deepwell plates (3960) - 6 cs
  • VWR Autoclave bags 14220-042
  • Cresol Red Sigma-Aldrich 114480-5GM
  • 48 Well E-gels (Invitrogen G800801)
  • 10ul Tips - ART Reach (4 cases - 40 tip boxes) (VWR 53509-500)
  • clear, skirted PCR plate (1 box of 25) (47744-124)
  • LB Agar (9 bottles) (VWR 90003-112)
  • Petri Dishes (3000, 6 boxes of 500) (25384-250) -- only ordered 2 boxes
  • 20ul pipette tips (4 cases - 40 tip boxes) 14217-726
  • Reservoirs (2 boxes) (new #: 89094-658)
  • VWR Foil Seals (8 boxes of 50 seals) (VWR 60941-076)
  • Glass Beads (2 bottles) (VWR 26396-521)
  • Avery Easy Peel Address Labels (4 packs) (8160)
  • 10ul Tip Racks MC (SR-L10F) (4 cases - 20 tip boxes)
  • 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
  • 1.2ml Tip Racks MC (RT-L1200F) (3 cases - 15 tip boxes)
  • 96 well Round Bottom Plates (2 boxes) (3958)
  • 96 well Deep Well Plates (2 boxes) (3960)
  • 1300 Cm Plates
  • 600 Amp Plates
  • Microflex Gloves (S, M, & L?) EV-2050-L
  • VWR Foil Seals (VWR 60941-076)
  • Perfect Prep Kit
  • Agar Broth/Plates
    • LB Agar (3 bottles) (VWR 90003-112)
    • Petri Dishes (1200 count at least) (25384-250)
    • SOB Media (1 bottle) (VWR 90003-336)
    • LB Broth (2 bottles) (VWR 90003-118)
    • Chloramphenicol (C0378-5G)
    • Ampicillin (A9518-25G)
    • Kanamycin (K1637-5G)
    • Tetracyclin (87128-25G)
    • 96 well Deep Well Plates (3960)
  • Restriction Digests
    • EcoRI
    • PstI
    • NEB Buffer 2
    • Hard Shell PCR Plates (twin.tec) (VWR 47744-124)
    • 48w E-gels
  • Pipette Tips
    • 10ul Tip Racks MC (SR-L10F)
    • 250ul Tip Racks MC (SR-L250S/F)
    • 1.2ml Tip Racks MC (RT-L1200F)
  • Brother TZ-241 Tape 3/4inch 18mm (White)
  • Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK)
  • Bubble Wrap
  • Perfectprep Plasmid 96 VAC 10/pk Kit
  • epTIPS 40-1000uL (Cat No. 960-05008-8)
  • epMotion Resevoir - 100mL (Cat No. 960051017)
  • epMotion Resevoir - 30mL
  • VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • Corning MiniPrep Assay Plates 2ml - 3960
  • VWR 200uL Barrier Tips (Cat No. 14217-728)
  • 10ul/20ul Tip Racks (SR-L10F)
  • 2.0mL Microtubes - (MCT-200-C-S)
  • Bleach
  • Corning 96w Clear Flatbottom Plates - 3651
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
  • PCR Supermix
  • 12-well E-gels
  • Falcon 14ml Snap Cap Tubes (352059)
  • VWR Reagent Reservoirs (new #: 89094-658)
  • Glass beads (VWR 26396-521)
  • Aluminium Foil
  • 2-log Ladder from New England Biolabs #N3200L
  • EcoRI
  • NheI
  • Sigma Aldrich 123072-5G, Luminol, 5 gram (never received)
  • LB Agar
  • Nunc Ampule Boxes [Cartridges] #534479
  • Nalgene Cryoware, cryogenic vials
  • E-Gel 0.8% agarose, 18 per box, Cat no, G5018-08, Invitrogen
  • 2x 4 liter 10x TAE buffer
  • 2x QS710 gel casting tray with casting system, VWR IB51030
  • 5x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
  • 5x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
  • QS710 horizontal gel unit, VWR IB51000
  • 50 ml pipets
  • pack 500, Axygen 0.5 ml tubes, orange, SCT-050-SS-O VWR 10011-516
  • pack 500, Axygen 0.5 ml tubes, red, SCT-050-SS-R VWR 10011-520
  • pack 500, Axygen 0.5 ml tubes, green, SCT-050-SS-G VWR 10011-512
  • pack 500, Axygen 0.5 ml tubes, yellow, SCT-050-SS-Y VWR 10011-526
  • Ethanol (200 and 190 proof)
  • Promega Wizard SV96 PCR cleanup startup kit, Promega A6790, VWR PAA6790
  • Qiagen Miniprep kit-- down to last bag of columns and I will probably use them between this week and next week. . .
  • PCR SuperMix
  • NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
  • twin.tec PCR plate 96, skirted (Eppendorf# 951020486, VWR# 47744-124)
  • Nunc Clear Lids (Universal) VWR 62409-118
  • VWR Reagent Reservoirs (new #: 89094-658)
  • 3m Micropore Tape
  • Falcon 14ml Snap Cap Tubes (352059)
  • case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
  • Adhesive Foil for Microplates (VWR Cat No. 60941-076)
  • Fireboy Butane Canisters (CV360) VWR 17919-890
  • 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
  • 3x cases 200 ul pipet tips, VWR 14217-728
  • 3x cases 20 ul pipet tips, VWR 14217-726
  • 3x cases 1000XL pipet tips, VWR 87006-060
  • VF2 (for Vinoo)
  • VR (for Vinoo)
  • Suffix-F 5' A CTA GTA GCG GCC GCT GCA G 3' (for Vinoo)
  • Prefix-R 5' T CTA GAA GCG GCC GCG AAT TC 3' (for Vinoo)
  • 2 boxes 12 well 0.8% e-gels Invitrogen G5018-08
  • Sterile reagent reservoirs 100ml case 100 VWR 82026-358
  • 2x NEB DpnI R0176S
  • Replacement parts for Eppendorf rotor A-4-62, should be available through VWR
    • Eppendorf Replacement rubber mat, for 250 ml bucket adapters, set of 4 Eppendorf 022638483
    • 2x Replacement adapter clamp, for 250 ml bucket adapters, set of 2 Eppendorf 022638467
  • Difco LB Agar, Lennox
  • 10ul Multichannel pipette tips
  • Pack 16, TimeMed Indicator tape, 3/4" x 500", TimeMed TSI-534, VWR 14217-334
  • Pack 16, Time Tape Red,3/4 in, 500" long, VWR 36427-040
  • Pack 16, Time Tape Green,3/4 in, 500" long, VWR 36428-043
  • Pack 16, Time Tape Yellow,3/4 in, 500" long, VWR 36426-048
  • Pack 16, Time Tape Orange,3/4 in, 500" long, VWR 36427-506
  • Pack 12, Griffin Low Form Beakers, 1000 ml, polypropylene, Nalgene 1201-1000, VWR 13915-147
  • Beckman pH electrode, Epoxy, Semi-Micro, Gel-Filled, 6 x 150 mm, Beckman A51711, VWR BKA51711
  • 3/4" TZ Labelling Tape (White)
  • Case 72, Square polypropylene bottles, Narrow mouth, 30 ml, Nalgene 2016-0030, VWR 16120-732
  • 2x Qiagen Genomic Tip 500/G, catalog 10262, Genomic DNA maxiprep kit
  • 2x Qiagen Genomic DNA Buffer Set, catalog 19060
  • 2x bottles bleach
  • 1 case petri dishes
  • Case 72, Boston Round polypropylene bottles, Narrow mouth, 8 ml, Nalgene 2006-9025, VWR 16066-981
  • 2-hydroxy-propyl-beta-cyclodextrin Sigma H5784, 45% solution, 0.67 substitution, MW 1396
  • Sigma C8754-5g co-carboxylase, 5 grams
  • Sigma C3144-25mg Coenzyme A sodium salt, 25 mg
  • Sigma F6625-100mg FAD, 100 mg
  • Sigma N5755-100mg, NADH, 100 mg
  • Sigma G8645-25g, Sodium glucuronate, 25 g
  • Sigma A5960-25g, Ascorbic Acid, 25 g
  • Sigma B4501-1g, biotin, 1 g
  • Sigma P5710-25g, Calcium panothenate, 25 g
  • Sigma P1504-100ml, Tween-40, 100 ml
  • 48well E-Gel
  • Nitrile gloves, medium
  • Nitrile gloves, large
  • PCR SuperMix cat: 10790-20, 2x5 each Invitrogen
  • Sigma E6376 Erythromycin, 25 g
  • 2x bottles Difco LB Agar, Lennox
  • Petri Dishes w/ Ring (PD1905-500S) 2 boxes
  • 20ul Pipette Tips
  • 3x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
  • 3x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
  • 2x boxes E-Gels 12 well 0.8%
  • 20ul pipette tips
  • Axygen 2.0ml microtubes
  • Qiagen Miniprep Kit
  • Qiagen PCR Purification Kit
  • 14 ml Falcon Polypropylene Round-Bottom tube, cat. # 352059
  • Sybr Safe
  • 2x bottles Difco SOB Medium #244310, 500g
  • Qiagen
    • 9012595 Disposable Tips, 1100 ul (960)
    • 9012596 Disposable Tips, 300 ul (960)
  • From (use the two codes AUSTIN100 and A7780WT to get 5% off and free shipping)
    • Chill Bucket Kit SKU #67218-100
    • 8 Liters Bath Armor SKU #42370-008
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • C-5097-100 ECOS 101 cells from
  • case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
  • 3x SpeI NEB R0133S
  • 3x XbaI NEB R0145S
  • 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
  • 3x cases 200 ul pipet tips, VWR 14217-728
  • 2x cases 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
  • Fireboy Butane Canisters (CV360) VWR 17919-890
  • E-Gel 0.8% agarose (G5018-08), may want to order two-four boxes of these
  • Invitrogen PCR SuperMix High Fidelity (10790-020), may want to order two since have been disappearing at high rate; ordering a 5000 rxn kit would be best
  • invivogen LyoComp - E.coli GT116 lyo-116-11
  • Sigma B6650-10MG 5-Bromo-4-chloro-3-indolyl β-D-glucuronide cyclohexylammonium salt
  • Sigma S2647-100MG Spectinomycin dihydrochloride pentahydrate
  • Macherey-Nagel
  • Medium latex gloves
  • autoclave deodorizers (VWR 11214-703)
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • 4x each of following
    • L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
    • L1004 - LB Agar Plates with Ampicillin-100. 100 mm Plates, sterile. 20 Pack.
    • L1017 - LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack.
    • L1232 - LB Agar Plates with Chloramphenicol-34, Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 200ul pipette tips
  • 20ul pipette tips
  • Qiagen spin miniprep kit 250
  • Qiaex II gel purification kit
  • 48-well egels
  • 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
  • 10uL pippette tips
  • L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack.
  • L5025 - LB Agar Plates with Kanamycin-50. 150 mm Plates, sterile. 20 Pack.
  • L5004 - LB Agar Plates with Ampicillin-100. 150 mm Plates, sterile. 20 Pack.
  • L5017 - LB Agar Plates with Chloramphenicol-34. 150 mm Plates, sterile. 20 Pack.
    • Cat #: 24108 - 24 well square well plate - 1 case
  • 6 sleeves LB-Tet plates from Teknova (VWR 100216-604)
  • 1 box 14 mL culture tubes
  • 48 well e-gels
  • 250ul Multi-Channel Tips (Rainin SR-L250S)
  • 5 boxes of NEB 10-beta competent cells - # C3019I
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • NEB BstXI
  • XbaI
  • 20ul tips
  • Tet plates from Teknova
  • 2x boxes 12 well E-Gels
  • Glass beads (VWR 26396-521)
  • 2x NEB SpeI R0133S
  • 2x NEB EcoRI-HF R3101S
  • T4 DNA ligase (everyone seems to be out, order at least two aliquots?)
  • 3x NEB 10-beta competent cells - # C3019I
  • BioBrick assembly kit
  • Teknova plates for distribution
  • NUNC lids
  • L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack - 4 of these
  • reservoirs (VWR 82026-358)
    • minimum quantity of each of following
    • Cat #: 47025 - 24 column, low profile plate
    • Cat #: 96012 - 8 channel V-trough reservoir
    • Cat #: 24108 - 24 well square well plate
  • E-gels, .8% Agarose, 12 lane (down to last box, ~5 used already)
  • 10ul multi-channel pipet tips, there was only one left in the box today and I couldn't see any other boxes.
  • Nutrient Broth (Difco 234000)
  • Fireboy cartridges (VWR 17919-890)
  • 6x pairs of scissors (apparently someone eats them)
  • ATCC 49762 Providencia stuartii
  • 3 cases 50 ml serological pipets BD 357550 (VWR 53106-441)
  • 3 cases 10 ml serological pipets BD 357551 (VWR 53300-523)
  • 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
  • 384-well plates (for Distribution)
  • LB Agar Lennox (VWR 90003-112)
  • 2x case 200 Autoclave bags, clear, VWR 14220-042
  • petri dishes (25384-250)
  • 10 ul tips (53509-500)
  • Bleach
  • lab notebooks (VWR TX126643MT)
  • EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
  • NEB 10-beta competent cells - # C3019I (order two boxes)
  • 2-log Ladder from New England Biolabs #N3200L
  • NEB M.EcoRI M0211S
  • NEB SbfI-HF R3642S
  • adhesive foil covers (for Distribution)
  • L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack - 8 of these (for postdocs)
  • PstI large
  • XbaI large
  • SpeI large (postdocs 3/11/09)
  • Invitrogen PCR Supermix Hi-Fi (postdocs, 3/11/09)
  • Qiagen QiaQuick PCR purification kit 250 - cat no. 28106
  • 96-well egels
  • 48-well egels
  • 20ul tips
  • 200ul tips
  • adhesive foil covers (VWR 60941-076)
  • Bio Rad Order # IC0282947
    • Biorad MLL-9601 - low profile unskirted natural pcr plates - ordered 1 pk
    • Biorad MSP-9601 - microseal skirted natural - ordered 2 pks
  • Millipore Millex-GV Filter unit 0.22 um pore size filters catalog no. SLGVR25LS (Req #11115919)
  • Microflex latex gloves small and large
  • 2 boxes of 12 well E-gels (Req #11121281)
  • Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
  • GE templiphi 500 25-6400-50
  • Teknova plates: (ReqID #11115915)
    • Amp L1004
    • Amp-Cm L1243
    • Amp-Kan L1210
    • Amp-Tet L1216
    • Kan L1025
    • Cm L1017
  • NEB Order# 219818-OL
    • NEB - EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
    • NEB lambda exonuclease M0262S
    • NEB exonuclease III M0206S
    • NEB 10-beta competent cells - # C3019I (order two boxes)
  • Egels 12 well 0.8%
  • NEB 10-beta competent cells - # C3019I
  • 14 ml Polypropylene Round-Bottom Tube
  • 12300-50 6 minute mini plasmid prep kit
  • ReqID 11110523:
  • Phusion™ High-Fidelity PCR Master Mix with HF Buffer catalog # F-531S
  • parafilm
  • 48 well e-gels
  • NEBbuffer 2 (unless we have a stash somewhere, we used 2 of 4 tubes in big -20)
  • NEB T4 DNA ligase
  • NEB 10-beta competent cells - # C3019I
  • Acinetobacter baylyi ATCC 33305
  • 2 cases petri dishes
  • ReqID 11106769
    • Fireboy gas canisters (VWR 17919-890)
    • adhesive foil covers (VWR 60941-076)
    • LB broth
  • NEB streptavidin magnetic beads S1420S
  • ReqID: 11105446
    • Invitrogen PCR Supermix High Fidelity (Invitrogen 10790-020)
  • 100 cylindrical 0.125x0.125 magnets
  • 100 cube 0.125 x 0.125 magnets
  • 50 cube 0.187x0.187 magnets
  • ReqID: 11104249
    • case N-DEX gloves, large
    • case N-DEX gloves, medium
    • cases of 10,20,200,and 1000 pippette tips (no full cases of any left, though there are a few boxes of the 1000s)
  • Invitrogen PCR SuperMix
  • Invitrogen ChargeSwitch CS10201 (for assembly)
  • Roche Protease Inhibitor, Complete Mini, EDTA-Free, 11836170001
  • Sigma D-7384-100G, Decanal
  • NEB EcoRI-HF R3101S
  • 2x boxes Invitrogen 12-well 0.8% E-Gels
  • Req ID: 11084279
    • 2 case petri dishes
    • GL45 media bottle caps, membrane, blue, Kimax 14395M45, VWR 89000-948, box 10
  • Qiagen miniprep kit --Meaganl 11:45, 21 November 2008 (EST)
  • NEB EcoRI R101S --Meaganl 11:45, 21 November 2008 (EST)
  • NEB T4 DNA ligase M0202S --Meaganl 11:45, 21 November 2008 (EST)
  • 3x Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
  • L-Arabinose- A3256-100G Sigma
  • 3x Difco LB Agar, Lennox, 500g
  • 2x gal bleach
  • Difco Agar Noble 500g Ref 214230 (ON BACKORDER)
  • MRS broth, BD 288130, 500g VWR 90004-082 (Temporarily on backorder)
  • Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
  • NUNC 5-spot grey holder boxes VWR #534479
  • 20x Gibco yeast extract Cat. # 18180-059
  • Sigma C5080-500g Calcium chloride dihydrate, Sigma-Ultra
  • large latex gloves evolution one Reorder #: EV-2050-L
  • Case Kimwipes, EX-L
  • Sterile reagent reservoirs 100ml case 100 VWR 82026-358
  • 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • Sigma M1633-1G 4-Methylumbelliferyl beta-D-galactopyranoside
  • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
  • 2x EMD OmniPur Sucrose 500g
  • 3mm glass balls (for spreading transformed cells on plates)- no more left
  • Difco Heart Infusion Broth Ref. # 238400, 500 g
  • 1 case 10 Axygen MCT-200-C-S microtubes
  • 1 case 10 Axygen MCT-175-C-S microtubes

(Req ID: 11027695)

  • 2x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
  • nalgene cryoware cryogenic vials Cat #5000-0020 (last case, 2 bags left-order Thurs. July 10th if possible)
  • case BD 305491 5 gal sharps containers (VWR BD305491)
  • 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 14 mL culture tubes
  • case 1000 BD 352054 5ml culture tubes (VWR 60819-310)
  • case 72 VWR Traceclean 20 ml vials with fluoropolymer resin/silicone septum VWR 15900-008
  • case 72 Nalgene boston round bottles, 8 ml, polypropylene, NNI 2006-9025, VWR 16066-981
  • 2 cases 200 ul pipet tips, barrier, sterile, racked VWR 14217-728
  • NEB M0201S T4 polynucleotide kinase
  • 2 x TOP10 one-shot chemically competent cells SKU# C4040-03
  • Egel 12 lane gels .8 or 1%, only 5 or 6 are left
  • Qiagen RNeasy Protect Bacteria Mini Kit Cat. #74524
  • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
  • Qiagen RNase-Free DNase Set Cat. #79254
  • ReqID: 11013874 (for PO)
    • 10x Rainin 250ul multichannel tips (SR-L250S)
    • 10x 1200ul multichannel tips
  • 2x DpnI from NEB (amount in -20 freezer restriction enzyme box is gone) Note: You can get the following free from NEB
  1. Receive a free Protein Ladder Sample with any purchase.
  • 2x NEB Phusion Flash high fidelity master mix F-548L (large version)
  • EMD OmniPur Sucrose 500g
  • 3M Micropore breathable cover for 96-well plates
  • 4x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
  • 2x Invitrogen S.O.C. medium 10x 1 ml, #15544-034
  • Costar 3370 (96 well flat bottom assay plate)
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 2x Rainin 250ul multichannel tips (SR-L250S)
  • 2x 1200ul multichannel tips
  • NEB BfuCI R0636S
  • Sigma beta-galactosidase G4155-1KU
  • large latex gloves evolution one Reorder #: EV-2050-L
  • greiner 96-well plates catalog #T-3026-16
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076 (ReqID: 11000465)
  • Invitrogen PCR SuperMix (only 2 tubes left) (ReqID: 11000464)
  • Rainin 250ul multichannel tips (SR-L250S)
  • 1200ul multichannel tips
  • ReqID: 10996069
    • Case 50, Greiner 2 ml clear Masterblock deep well plates, sterile, Greiner 780271, VWR 82051-248
    • 2x case 50, Nunc Microwell 96-well polystyrene plates, sterile, 0.3 ml, V-bottom, Nunc 249662, VWR 62409-112 (ON BACKORDER - SHIPPING 5/12)
    • 2x case 50, Nunc Microwell plate lids, sterile, cut off corners, Nunc 264122, VWR 62409-118 (ON BACKORDER - SHIPPING 5/6)
    • 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502 (ON BACKORDER - SHIPPING 5/22)
  • Sciencelab 60-136380518 polyethylene fritware sheet, 70 micron, 18"x18" 1/8" thick
  • ReqID: 10913140
    • Daigger FX23461AX 96 well PCR racks, assorted colors, 4x pack 5 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
  • Get these Greiner plates instead: Endy:Victor3_plate_reader/Plates (catalog # T-3026-16) (reqID: 10996115)
  • 20x Invitrogen/Gibco yeast extract 18180-059 (ReqID# 10996112)
  • 6x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011) (Order # 107945)
  • 2x NEB Buffer 2 pack, B7002
  • Rainin 10ul multichannel tips (SR-L10S)
  • ReqID: 10996069
    • 3x Sterile reagent reservoirs 100ml case 100 VWR 82026-358
    • 3x Petri-stickers, Diversified Biotech PSTK-1050, [1]
    • 3x cases 200 ul pipet tips
    • 2x cases 20 ul pipet tips
    • 2x pack 50 VWR electroporation cuvettes, 1 mm, 89047-206
    • Difco Heart Infusion Broth, 238400, 500g
    • Difco/BD 220215 sterile disposable inoculating loop, 1 ul, 50/tube, pack 1000, VWR 90001-098
  • ReqID:
    • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
    • Sigma I1284 IPTG
  • NEB protein ladder, P7703S
  • Rainin 250ul multichannel tips
  • 2x NEB DpnI R0176S
  • aluminum foil
  • 2x gal Pharmco ethanol, 190 proof
  • 2x gal Pharmco ethanol, 200 proof
  • 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
  • pack 50 VWR electroporation cuvettes, 1 mm gap VWR 47727-640
  • pack 50 VWR electroporation cuvettes, 2 mm gap VWR 47727-642
  • 3x cases petri dishes
  • Axygen screw top microtubes, amber, 0.5 ml, self standing, ST-050-SS-X, VWR 10011-656, pack 500
  • 2x case 10 ml pipets
  • 2x case 25 ml pipets
  • 2x case 50 ml pipets
  • Pfu turbo DNA polymerase catalog no 600250 from Stratagene
  • Qiagen ERC MinElute cleanup kit large #28206
  • 20x Brother TZ-241 3/4" black on white label tape
  • Sigma M1633-250MG 4-Methylumbelliferyl beta-D-galactopyranoside
  • NEB PvuII R0151S
  • Sigma 43816-50ML, DTT, 1 M solution, 50 ML
  • Sigma D0632-10G, DTT, 10g
  • Invitrogen NuPage MOPS SDS running buffer, 20X, 500 ml, cat NP0001
  • Invitrogen NuPage LDS sample loading buffer (4x) 10 ml, cat NP0007
  • Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
  • NEB Chitin beads S6651L (large version)
  • pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
  • sterile inoculating loops
  • NEB B0202S T4 DNA Ligase buffer pack (4x 1.5 ml buffer)
  • 2x Invitrogen NuPage 10% Bis-Tris Gels, 1.0mm x 9 well, cat NP0307BOX
  • ReqID: 10970539 (6)
    • 2x Difco SOB medium 244310, 500g (On backorder)
    • 4x gal bleach
  • Fermentas PpiI, cat #: ER1541, 50 units, $66
  • SibEnzyme MabI, cat #: E121, 200 units, $40
  • SibEnzyme PsrI, cat #: E131, 100 units, $50


  • ReqID: 10975136
    • Molec bio grade ethanol (Sigma 7023-500ml)
  • ReqID: 10975027
    • (3) NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
  • ReqID: 10974958
    • Qiaprep Spin Miniprep Kit (250), Cat. #27106
    • Reagent reservoirs
    • (5) Teknova Amp plates
  • ReqID: 10974975
    • GE(Amersham) templiphi 100
  • Epicentre EZ-Tn5 transposase
  • 2x case 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
  • 10ul tips (VWR 53509-500)
  • NEB EcoRI
  • NEB XbaI
  • NEB T4 PNK M0201S
  • ReqID: 10968275
  • Sterile inoculating loops (VWR 12000-810)
  • Teknova AMP plates (VWR 100216-550)
  • Media cart for holodeck
  • ReqID: 10967075
    • Glycerol
    • Sigma C5080 Calcium Chloride dihydrate, 500g
  • ReqID: 10967081
    • Microgrip Nitrile Gloves (40101-346)
    • half-height round bottom 96-well plates - 3cs (82051-244)
  • ReqID: 10963590
    • Pierce 31503 Superfreeze peroxidase conjugate stabilizer, 25 ml
  • Costar 3960 (96 deep well culture plates)
  • 1 case 10 Axygen MCT-200-C-S microtubes
  • ReqID: 10963547
    • 0.8% 12 well e-gels from Invitrogen (G5018-08)
    • Invitrogen 10x TAE
  • ReqID: 10963590
    • 3x case 200 ul pipet tips (VWR 14217-728)
    • Falcon 14ml tubes 352059 (VWR 60819-761)
    • freezer boxes (w foam inserts) (Nalgene 5055-5015)
  • ReqID: 10963609
    • PBS (pH 7.4) 1L
  • EZ-Tn5 transposase
  • 1 case 10 Axygen MCT-060-C-S microtubes
  • 1 case 10 Axygen MCT-175-C-S microtubes
  • 3x case Nalgene Cryoware Cryo Vials, Cat # 5000-0020
  • 2x case 10 ml disposable pipets
  • 2x case 50 ml disposable pipets
  • ReqID: 10956768
    • Reagent reservoirs, VWR 82026-358
    • Teknova Amp plates (L1004)
    • 4 bottles LB agar (240110)
    • Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
    • Autoclave bags, 25" x 35", VWR 14220-042
    • Petri dishes, two cases (25384-250)
  • ReqID: 10954559
    • Invitrogen PCR Supermix
  • 10 ul tips
  • --Meaganl 13:43, 9 January 2008 (CST)
    • Req ID: 10949471
      • 2x Sucrose, EMD Omnipure, 500 g
    • 20x Brother TZ-241 3/4" black on white label tape
    • Req ID: 10949254
      • Difco 0142 Agar Noble, 500g
      • 2 dozen Campingaz / Coleman CV360 butane canisters (for Fireboy) VWR 17919-890
      • 1000ul tips
    • Pierce EZ-link Psoralen-PEO-biotin, 5 mg #29986
    • Pierce Streptavidin Horseradish peroxidase conjugated, 1 mg, # 21126 (in -20)
    • Pierce Immunopure biotinylated horseradish peroxidase, 5 mg, # 29139
    • Pierce One-step Ultra TMB-substrate, 250 ml # 34028
    • Pierce Ultralink immobilized streptavidin, 2 ml, # 53113
    • Req ID: 10949274
      • Sigma M0262 Methylcellulose viscosity 400 cP, 2 % in H2O, 100g
      • Sigma E5529 EZ-view red streptavidin affinity gel, 1 ml
    • case BD sharps collector 3.1 liter BD 305488
    • Qiagen ERC MinElute cleanup kit large #28206
  • Req ID: 10937895
    • Nitric acid, concentrated, 1 liter
  • NEB BsmBI R0580S
  • ReqID: 10946402
    • Invitrogen Sybr Safe
  • ReqID: 10946457
    • Sigma Aldrich 151238 Glycidyl methacrylate 5 grams
    • Sigma B9300 Benzophenone 500 grams
    • Sigma Aldrich 311448 Sodium periodate 5 grams
    • Sigma S4762 Streptavidin 1 milligram
    • Sigma T4174 10×, 5.0 g porcine trypsin and 2 g EDTA • 4Na per liter of 0.9% sodium chloride 100 ml
    • Sigma T4799 Trypsin from procine pancreas 5 grams
    • Sigma T9003 Type I-S Trypsin inhibitor, lyophilized powder (Sigma), 100 milligrams
  • 200ul tips
  • ReqID: 10943944
    • 5x horse serum, Sigma
  • 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
  • ReqID: 10943885
    • Qiaprep Spin Miniprep Kit (250), Cat. #27106
  • 8 strip ultra clear caps Cat No TCS-0803 clear from MJ Research (now BioRad - same cat. number)
  • Low tube strip, CLR from BioRad catalog no. TLS0801 (please buy equal numbers as caps
  • Rainin SR-L250S multichannel tips (250 uL capacity)
  • Harris Uni-Core punches, 0.35, 0.50, 0.75, 1.0 mm, four each, Ted Pella
  • Hydrochloric acid, concentrated, 1 liter
  • EZ-Tn5 transposase, Epicentre, EZ-Tn5
  • Req ID: 10937925
    • 6x Horse Serum, Donor Herd, Sigma H1138, 500 ml
  • 200μL multichannel tips from Rainin
  • Acetic acid, glacial, 1 liter
  • ReqID: 10936396
    • 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
    • large latex gloves evolution one Reorder #: EV-2050-L
    • Difco LB Agar, Lennox, 500g
  • 1 box Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • multichannel 10ul tips Rainin SR-L10F
  • Ptouch label supplies 3/4in white background, black ink - TZ-241
  • Zymo ZR96 genomic DNA kit, 4 x 96 well plates D3011, Zymo site
  • Amylose resin from NEB (Catalog no. E8021S) --Reshma 14:38, 25 November 2007 (CST)
  • NEB PstI
  • P1000 tips
  • Qiaprep Spin Miniprep Kit (250), Cat. #27106 (only 10 or so columns left may want to order before Thurs)
  • Qiagen Qiaex II Gel Extraction Kit, Cat. #20051
  • NEB MboI (large) R0147L
  • 1 NEB T4 DNA Ligase M0202S (need before Thursday)
  • Invitrogen Sybr Safe
  • ReqID: 10930951
    • Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
    • 2x case 12 Nalgene 291-4520 SFCA Bottle Top Filter 75mm dia filter, 45 mm cap, VWR 28199-307
    • 3x Novagen Pellet Paint NF #70748 (available through VWR)
    • 2x case Nalgene cryo vials Nalgene 5000-0020
  • Sau3AI, NEB R0169S
  • PvuII, NEB R0151S
  • Phusion HF master mix, NEB F531S
  • pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
  • ReqID: 10923808
  • EZ-Tn5 transposase, Epicentre, EZ-Tn5
  • Req ID: 10920911
    • VWR 12x75mm polypropylene round bottom sterile tubes Cat No 60818-576
    • BD Falcon 352054 5ml polystyrene falcon tube
    • 2x cases 50 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-028 --Meaganl 12:31, 17 October 2007 (CDT))
    • 2x cases 15 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-024 --Meaganl 12:31, 17 October 2007 (CDT))
    • 2x 1/4 oz. Immersion oil type DF low fluorescence, CARGILLE LABORATORIES, VWR 48218-506
  • VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (another one, now that we know they work well)
  • 2x boxes 12 well 0.8% agarose E-Gels
  • exo I M0293S
  • DpnI R0176S
  • ReqID: 10915844
    • Sodium deoxycholate from Sigma 30970-25G
  • MboI NEB R0147S
  • 2x cases Petri dishes
  • Pack 768 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul (on backorder)
  • Daigger FX4727A 250 ml polypropylene centrifuge tubes, 250 ml, Pack 12 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
  • VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (On backorder until 9/24) --Meaganl 14:45, 20 September 2007 (EDT)
  • ReqID: 10906942
    • Falcon 14ml tubes 352059 (3 boxes, we go through them fast)
    • 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
    • case 12, Nalgene MF75 Bottle top vacuum filters, Surfactant free CA, 500 ml, 0.20 micron, NNI 291-4520, VWR 28199-307
    • ART 10ul tips
    • Pack 768 VWR 87006-058 Barrier tips, sterile, 250 ul
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • 6x Invitrogen/Gibco Yeast extract, 100 ml, cat. 18180-059
  • ReqID: 10904172
    • Roche Dig-High Prime DNA labeling and detection starter kit II for chemiluminescent detection cat 11 585 614 910
    • Roche Digoxigenin-11-dUTP, alkaline labile 25 nmol, cat 11 573 152 910
  • ReqID: 10904145
    • BD 35 2059 polypropylene round bottom tubes, 14 ml, 17 x 100 mm
  • ReqID: 10904171
    • Sigma 77617 Fluka Biochimika ultra Phenol Chloroform Isoamyl alcohol mixture 25:24:1, 100 ml
  • ReqID:10898629
  • Pierce B-PER bacterial protein extraction reagent 500 ml #78248
  • Req ID: 10901718
  • Invitrogen UltraPure Agarose 15510-027
  • Invitrogen Sybr Safe
  • ReqID: 10901688
    • 3x pack 1000 MCT-060-C-S
    • 1x case 10 MCT-175-C-S
    • 1x case 10 MCT-200-C-S
    • 2x pack 100 Axygen Cyclerseal PCR-TS, VWR 10011-120
    • case 36 BD 353226 24 well plates, 6/bag, VWR 62406-159
  • NEB P8101S Modified Trypsin
  • NEB S6651S Chitin beads
  • NEB M0280S UDG
  • Roche Complete mini EDTA free protease inhibitor cocktail, glass vial 25 tablets, 11 836 170001 --Meaganl 10:12, 4 September 2007 (EDT)
  • 3x Crane's Thesis Paper100% Cotton, Acid Free, 500 sheets (SKU BT886S)
  • Daigger FX28271J 6x10 4 mil polyethylene bags, case 1000
  • recombinant EGFP 100ug (Order # 120924)
  • Nalgene Cryoware Cryo Vials, Cat # 5000-0020 --Meaganl 10:50, 22 August 2007 (EDT)
  • 2x VWR 55411-050 single edge razor blades, pack 100 --Meaganl 10:50, 22 August 2007 (EDT)
  • Qiagen miniprep kit
  • Sap1 restriction enzyme
  • 95% ethanol
  • 100x Olfa Green Mat, 6" x 8
  • 6x Invitrogen 18180-059 Yeast extract solution --Meaganl 14:05, 14 August 2007 (EDT)
  • 2x Invitrogen E-Gel .8% Agarose, Cat #G5018-08 --Meaganl 14:05, 14 August 2007 (EDT)
  • Pfu turbo DNA polymerase catalog no 600250 (100 U) from Stratagene.--Meaganl 14:05, 14 August 2007 (EDT)
  • 100x Harris Uni-core punch, disposible, 2mm
  • Req ID: 10893241
    • 2x pack 50 VWR Signature electroporation cuvettes, 1mm gap, VWR 47727-640 --Meaganl 11:49, 14 August 2007 (EDT)
  • Topoisomerase 1 from E. coli 100 units catalog # M0301S
  • Epicentre EZ-Tn5 transposase TNP92110, 10 units
  • Req ID: 10890897
    • 3x cases 20 ul tips
    • 3x cases 200 ul tips
    • 3x cases 1000 ul tips
  • Invitrogen Sybr Safe
  • Harris Uni-core punch, disposible, 2mm
  • C. S. Osborne Belt punches, sizes 00, 0, 1, 2
  • Olfa Green Mat, 6" x 8"
  • Ptouch 3/4" white black ink labelling supplies TZ-241 (10x)
  • Qiagen Minelute PCR Cleanup Kit (250) # 28006
  • 2-log Ladder (from New England Biolabs) #N3200L
  • Invitrogen E-gel-48
  • NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX - 1 box
  • Req ID 10887733
    • Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
    • 100ml reservoirs VWR 82026-358
    • Falcon 14ml tubes 352059
    • Nalgene blue 16mm test tube racks (for holding 14ml tubes)- 60914-730
  • Req ID: 10886117
    • Difco LB Agar Lennox Ref. 240110
  • Foil adhesive covers (60941-074)
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • ReqID: 10883548
    • 2x cases petri dishes
    • 2x cases 12 Nalgene 290-4520 SFCA bottle top filter, 150ml, 45mm neck, 50 mm membrane, 0.2u filter
    • 2x PstI R0140S
    • Robot: SpeI
  • ReqID: 10878908
    • Bleach
  • multichannel 10ul tips Rainin SR-L10F
  • VF2 and VR Primers
  • Robot: 30ml and 100ml reservoirs
  • Alconox Alcojet dishwashing detergent (let me know if you need a catalog no.)
  • ReqID: 10874005
    • Sigma C7901-25G Chelex 100
  • SeeBlue® Plus2 Pre-Stained Standard - Invitrogen Catalog Number - LC5925
  • Robot: Invitrogen E-gel 48
  • MicroAmp™ Optical 96-Well Reaction Plate (Part# N8010560) - 10 Plate Package
  • 2x E-Gel 0.8% agarose (GP) #G5018-08
  • ReqID: 10871228
    • TempliPhi 100 Amplification Kit
  • NEB phi29 DNA polymerase M0269S
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • T4 endo VII
  • TDG H00006996-Q01
  • NEB BbsI R0539S
  • Robot: Sigma ATP (3x)
  • 1 500 mL bottle of Ethyl acetate catalog # MK499204 at VWR
    • BD Falcon 352063 (VWR 60819-728)
    • 14 mL culture tubes Falcon 352059 (VWR 60819-761)
  • DNA Topoisomerase I, Vaccinia (500 U)
  • Propidium iodide Invitrogen P1304MP
  • NuPAGE® Sample Reducing Agent (10X) NP0004
  • NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX
  • Immobilized Streptavidin Pierce #20349 (VWR # PI20349)
  • 100 ml multi-well pipettor reservoirs
  • Spherotech ACFP-100-3 AccuCount Fluorescent Particles 8.0-12.9 µm, 3 mL
  • 3x Novagen Pellet Paint NF #70748 (available through VWR)
  • Qiagen miniprep spin kit (250) # 27106
  • Qiagen Minelute PCR Cleanup Kit (250) # 28006
  • NEB M0302S endo I
  • NEB M0305S endo V
  • (2cs) Petri dishes
  • Sigma M2128 Thiazolyl Blue Tetrazolium 500 mg
  • K3007 N-(β-Ketocaproyl)-L-homoserine lactone from Sigma
  • polypropylene tubes VWR catalog# 60818-576
  • Spherotech RCP-60-5 calibration beads
  • 8 well strip tubes, clear, low profile
  • 1 case of 10ul tips (not via requisition; on CC)
  • Req ID: 10855012 Ampicillin salt (Sigma A9518)
  • Req ID: 10854533 TempliPhi 100 (Amersham/GE Healthcare)
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • Req ID: 10854540
    • two dozen black ultra-fine point Sharpies
  • Req ID: 10854530
    • case BD 305491 5 gallon sharps containers
    • case Nalgene 5055-5015 microcentrifuge box, 64 places, foam insert
    • 2 cs 10ul tips
    • 6 cs 20ul tips
    • 3 cs 200ul tips
    • 3 cs 1000ul tips
  • scotch tape. The rolls that can be put in existing dispensers.
  • large latex gloves
  • Mermaid kit, 200 preps, [2]
  • Geneclean III kit, 600 preps, [3]
  • (3) NEB T4 DNA Ligase M0202S
  • NEB phi29 DNA polymerase M0269S
  • ReqID 10851873
    • Sigma D157805-5G N,N'-dimethylethylenediamine
  • Invitrogen Sybr Safe
  • PO# 10847064
    • Nonidet-P40 substitute Sigma 74385-1L
    • Tween-20 Sigma P7949-100ML
    • Tween-40 Sigma P1504-100ML
    • Tween-80 Sigma P8074-100ML
  • Glycerol (Sigma G6279) -- on backorder
  • 1.7mL clear sterile tubes (Reshma) --Meaganl 09:43, 12 April 2007 (EDT)
  • Reshma 09:41, 19 March 2007 (EDT): Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
  • Trevigen TDG 4070-500-EB
  • Trevigen MutY 4000-500-K
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • Beckman reference solution 4M KCl, 4 x 100 ml, 566468 VWR BK566068
  • --Meaganl 14:44, 3 April 2007 (EDT)
    • Reshma 11:55, 23 March 2007 (EDT): SpeI
    • NEB EarI (yes again) R0528S
    • NEB endo IV M0304S
    • NEB endo VIII M0299S
  • Qiagen miniprep kit (large)--Meaganl 10:32, 3 April 2007 (EDT)
  • Immobilized Streptavidin Pierce #20349 (VWR # PI20349) --Meaganl 13:42, 26 March 2007 (EDT)
  • Reshma 11:23, 19 March 2007 (EDT): Nalgene cryovials
  • Reshma 17:06, 8 March 2007 (EST): 14 mL culture tubes Falcon 352059
  • Reshma 13:44, 8 March 2007 (EST): Difco LB Lennox Broth
  • NEB BsmBI R0580S --Meaganl 10:41, 22 March 2007 (EDT)
  • Ambion superase-in #2694 --Meaganl 15:16, 15 March 2007 (EDT)
  • Reshma: Qiagen ERC MinElute cleanup kit large #28206
  • Reshma: PCR supermix
  • --Meaganl 11:05, 9 March 2007 (EST)
    • case BD sharps collector 3.1 liter 305488
    • case standard petri dishes 100 x 15 mm VWR # 25384-250
    • 3x bottles bleach
    • 4 cases 1000 ul barrier pipet tips VWR 14217-730
    • 4 cases 200 ul barrier pipet tips VWR 14217-728
    • 3 cases 50 ml serological pipets BD 357550
    • 3 cases 10 ml serological pipets BD 357551
    • 1 case 25 ml serological pipets BD 357525
  • NEB phi29 DNA polymerase M0269S --Meaganl 16:29, 8 March 2007 (EST)
  • NEB BbsI R0539S --Meaganl 16:29, 8 March 2007 (EST)
  • NEB EarI R0528S --Meaganl 16:29, 8 March 2007 (EST)
  • Invitrogen Sybr Safe --Meaganl 16:27, 6 March 2007 (EST)
  • NEB T4 DNA ligase large (M0202L) PO# 0010830023 --Meaganl 08:49, 2 March 2007 (EST)
  • VWR 3 1/2 mm glass beads 1lb pack 26396-521 (PO# 10826298) tk 15:32, 26 February 2007 (EST)
  • Invitrogen E-Gels, 0.8% EtBr, Single comb, pack 18, G5018-08 tk 15:32, 26 February 2007 (EST)
  • PO #10825054
    • Sigma Aldrich Tetracycline BioChemika 87128-25G tk 15:32, 26 February 2007 (EST)
    • Sigma Aldrich Chloramphenicol BioChemika 23275-25G tk 15:32, 26 February 2007 (EST)
    • Sigma Aldrich Kanamycin K1637-5G tk 15:32, 26 February 2007 (EST)
  • PO# 10823861
    • GE Healthcare Sephacryl S-500 HR 150 ml, Cat 17-0613-01 VWR 95016-920 tk 15:32, 26 February 2007 (EST)
    • GE Healthcare Sephacryl S-400 HR 150 ml, Cat 17-0609-01 VWR 95016-912 tk 15:32, 26 February 2007 (EST)
    • GE Healthcare Sephacryl S-300 HR 150 ml, Cat 17-0599-01 VWR 95016-908 tk 15:32, 26 February 2007 (EST)
  • Polybead polystyrene red dyed microspheres, 0.2 micron, 2.5% aqueous solution, smallest amount tk 15:32, 26 February 2007 (EST)
    • Order # 47T9282PPGGQ8LDHCRF9WDNN82
  • PO#10822102
    • Sucrose, Omnipure, EMD, VWR #EM-8510, 500g
  • PO#10822065
    • 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
    • NEB BsmBI
    • 2x NEB 2-log ladder, large N3200L
  • P-10 tips (2 cases) --Meaganl 09:44, 2 February 2007 (EST)
  • Multichannel 1200ul pipette tips --Meaganl 09:44, 2 February 2007 (EST)
  • Bio-rad PCR strip tubes #TLS0801 (5 boxes) tk 19:13, 31 January 2007 (EST)
  • NEB β Agarase I M0392S --Meaganl 14:37, 31 January 2007 (EST)
  • Epicentre CircLigase #CL4111K --Meaganl 13:36, 30 January 2007 (EST)
  • Micropure EZ columns Catalogue Number: 42530 from Millipore (shipped on 1/26)--Meaganl 13:36, 30 January 2007 (EST)
  • Shipped on 1.26 --Meaganl 14:22, 29 January 2007 (EST)
    • Qiagen RNase-free Dnase set Cat #79254
    • Qiagen RNeasy minelute cleanup Cat #74204
    • Qiagen ERC MinElute cleanup kit #28204
  • EDTA disodium salt for molecular biology 500g Sigma E5134 --Meaganl 09:48, 24 January 2007 (EST)
  • Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 09:48, 24 January 2007 (EST)
  • Sigma M6880-25G (malachite green oxalate salt) --Meaganl 09:48, 24 January 2007 (EST)
  • DEPC - 25mL (Sigma) --Meaganl 09:48, 24 January 2007 (EST)
  • 2x packs 100, BD Syringe 3 ml Luer Lok, BD 309585 --Meaganl 09:48, 24 January 2007 (EST)
  • NEB N0345S Yeast Chromosome PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
  • NEB N0340S Lambda ladder PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
  • PMSF 100 mM in ethanol 50 ml Biochemika 93482 --Meaganl 14:56, 22 January 2007 (EST)
  • N-lauroyl sarcosine sodium salt 30% solution 100 ml Biochemika 61747 --Meaganl 14:56, 22 January 2007 (EST)
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250 --Meaganl 14:56, 22 January 2007 (EST)
  • 4L cubetainer of 10x TBE buffer VWR EM-8820 --Meaganl 14:56, 22 January 2007 (EST)
  • ClaI NEB R0197S --Meaganl 14:56, 22 January 2007 (EST)
  • P-10 tips --Meaganl 14:56, 22 January 2007 (EST)
  • 2 4L cubetainers of 10X TAE buffer Invitrogen #15558-026 --Meaganl 11:48, 18 January 2007 (EST)
  • SYBR gold (Invitrogen catalog number S-11494) --Meaganl 11:48, 18 January 2007 (EST)
  • Invitrogen Sybr Safe --Meaganl 11:48, 18 January 2007 (EST)
  • Nunc Deepwell 384-well plates
  • EcoR1, small (Robot)
  • SpeI, large (Robot) x2
  • PstI, small (Robot)
  • Eppendorf Robot Miniprep kits x2 --Reshma 15:17, 10 January 2007 (EST)
  • XbaI --Reshma 15:17, 10 January 2007 (EST)
  • Difco LB Agar, Lennox--Meaganl 10:39, 9 January 2007 (EST)
  • illustra TempliPhi 100 Amplification Kit (Amersham/GE Healthcare) tk 22:01, 22 December 2006 (EST)
  • 200 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • 20 ul pipet tips (2 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • 1000 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • Falcon 14ml tubes 352059--Meaganl 07:46, 21 December 2006 (EST)
  • AG 501-X8(D) Resin, molecular biology grade, 100 g, catalog number 143-6425 from Bio-Rad--Meaganl 07:46, 21 December 2006 (EST)
  • Sigma Molecular Bio Grade 200 proof ethanol--Meaganl 10:12, 20 December 2006 (EST)
  • RNaseZap wipes (Ambion AM9786)--Meaganl 10:12, 20 December 2006 (EST)
  • Alpha Innotech (replacement) EtBr filter EBR-500K
  • Qiagen miniprep kit (2 of these I believe) --Reshma 13:52, 9 December 2006 (EST)
  • Eppendorf 30ml robot reagent reservoirs --Meaganl 14:22, 3 December 2006 (EST)
  • 100ml sterile reagent reservoirs--Meaganl 11:26, 1 December 2006 (EST)
  • (VWR) Nalgene microcentrifuge tube boxes (case)--Meaganl 11:26, 1 December 2006 (EST)
  • Plastic disposible cuvettes, OPS, 10x10x45 mm, 2 optical surfaces, VWR 58017-825, case 500--Meaganl 11:26, 1 December 2006 (EST)
  • Plastic disposible cuvettes, OPS, 10x4x45 mm, 2 optical surfaces, VWR 58017-847, case 500--Meaganl 11:26, 1 December 2006 (EST)
  • Difco Bacto Agar 0140-01--Meaganl 11:26, 1 December 2006 (EST)
  • Sigma L5263-25KU, Lyticase from Arthrobacter luteus, partially purified--Meaganl 15:33, 30 November 2006 (EST)
  • Sigma 73660-5G Biochemika 99%+ 2-nitrophenyl β-D-galactopyranoside (ONPG)--Meaganl 15:44, 29 November 2006 (EST)
  • SpeI NEB R0133S--Meaganl 15:04, 28 November 2006 (EST)
  • NotI NEB R0189S--Meaganl 15:04, 28 November 2006 (EST)
  • β-Agarase I NEB M0392S--Meaganl 15:04, 28 November 2006 (EST)
  • Sigma 43816-50ml DL Dithiothreitol solution 1M Biochemika ultra -- tk 14:18, 27 November 2006 (EST)
  • Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
  • Sigma D5545-1G DL Dithiothreitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
  • Brother Labeler 18mm 3/4" black ink on white tape --Meaganl 10:06, 27 November 2006 (EST)
  • Nalgene microcentrifuge tube boxes (only got 4 boxes) --Meaganl 11:22, 20 November 2006 (EST)
  • BD 60ml syringes --Meaganl 11:22, 20 November 2006 (EST)